8.12. 유전자 탐색기 (Gene Explorer) 도구¶

<problem>
<p>Make a single base pair substitution mutation in the gene below that
results in a protein that is longer than the protein produced by the
original gene. When you are satisfied with your change and its effect,
click the <b>SUBMIT</b> button.</p>
<p>Note that a "single base pair substitution mutation" is when a
single base is changed to another base; for example, changing the A at
position 80 to a T. Deletions and insertions are not allowed.</p>
<script type="loncapa/python">
def genex_grader(expect,ans):
    if ans=="CORRECT": return True
    import json
    ans=json.loads(ans)
    return ans["genex_answer"]=="CORRECT"
</script>
<customresponse cfn="genex_grader">
<editageneinput width="818" height="1000" dna_sequence="TAAGGCTATAACCG"
"AGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAA"
"AAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_dna_sequence="TA"
"AGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTG"
"CGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT"
genex_problem_number="2"/>
</customresponse>
</problem>